mlp pilot Videos

Did you mean?

Search Results - Showing 60 - 72 Of 77

On April 22, 2010, the U.S. Air Force launched the super-secret X-37B space plane on its first spaceflight. <br/><br/>This space plane is also known as the Orbital Test Vehicle. It looks a lot like NASA's space shuttle, only it's much smaller and doesn't have any windows. But the X-37B doesn't need windows anyway, because no one actually flies in it. It's completely autonomous and can even land on a runway without a human pilot. The X-37B has flown several highly classified payloads on long-duration missions. For its first flight, the X-37B launched on an Atlas V rocket from Cape Canaveral and it orbited the Earth for 224 days. The Air Force never disclosed what kind of experiments were going on during that time.
⏲ 0:53 👁 820K
A spaceship from Hydra crashes on Sardinia. Aliens take a scientist, his daughter, technicians and spies hostage to fix their ship. After repairs, aliens abduct the humans but they rebel, sending the ship into deep space.
⏲ 1:26:29 👁 165K
Experience Virgin Galactic Unity's Galactic 02 flight with these amazing views from inside and out of suborbital space plane VSS Unity. <br/><br/>Passengers: Jon Goodwin, Keisha Schahaffand Anastatia Mayers.<br/>Crew:Commander C.J. Sturckow, pilot Kelly Latimer and Chief Astronaut Instructor Beth Moses.<br/><br/>Credit: Space.com | footage courtesy: Virgin Galactic | edited by Steve Spaleta<br/>Music: Far Far Far by Bonnie Grace / courtesy of Epidemic Sound
⏲ 4:36 👁 120K
As World War II rages, a formation of German paratroopers land in the hidden city of Palandria to exploit its wealth and they start taking hostages.<br/><br/>Johnny Weissmuller ... Tarzan<br/>Johnny Sheffield ... Boy<br/>Frances Gifford ... Zandra<br/>Stanley Ridges ... Colonel von Reichart<br/>Sig Ruman ... German Sergeant (as Sig Rumann)<br/>Philip Van Zandt ... Captain Bausch<br/>Rex Williams ... Lt. Reinhardt Schmidt<br/>Pedro de Cordoba ... Patriarch<br/>Louis Adlon ... German Officer in Berlin<br/>Sven Hugo Borg ... Heinz<br/>Stanley Brown ... Achmet <br/>George Lynn ... Nazi Pilot <br/>Manuel París ... Pallandria Man <br/>Otto Reichow ... Grüber <br/>Wilhelm von Brincken ... General Hoffman in Berlin <br/>William Yetter Sr. ... Nazi Guard
⏲ 1:13:11 👁 90K
Authorities are rushing to save more than 160 pilot whales from a mass stranding at a beach in western Australia, with at least 26 of them dead before authorities could begin a rescue attempt.
⏲ 1:1 👁 15K
#instaaviation #instagramaviation #aviationlovers #aviationgeek #plane #planespotting #planeporn #avporn #airplane #potd #pictureoftheday #pilot #pilotlife #aviation
⏲ 0:15 👁 15K
Terrible Emergency Landing
⏲ 0:30 👁 15K
Subscribe to DTB at http://digtb.us/subscribe<br/>Become a member (it's FREE) at https://digtb.us/signup<br/>Buy official DTB merch at http://digtb.us/merch<br/><br/>On this episode of DTB’s “Bus Invaders (Revisited)”, we take you inside the touring vehicle of the hard rock band, Escape The Fate, while on tour with Papa Roach and Otherwise, back in 2013. Escape The Fate is currently supporting their newest album, Out Of The Shadows.<br/><br/>VIDEO INFO:<br/>Film Date - May 15, 2013<br/>Location -Impact Fuel Room in Libertyville, IL<br/><br/>KEEP UP WITH ESCAPE THE FATE:<br/>Facebook - https://facebook.com/escapethefate<br/>Instagram - https://instagram.com/escapethefate<br/>Twitter - https://twitter.com/escapethefate<br/><br/>WATCH MORE BUS INVADERS EPISODES:<br/>https://www.youtube.com/watch?v=NPwQrkP9P6I<br/>https://www.youtube.com/watch?v=vIo5Gl05wsM<br/>https://www.youtube.com/watch?v=i5GBEnuIReA<br/>https://www.youtube.com/watch?v=-SBs_6YHwbM<br/>https://www.youtube.com/watch?v=A7PXoVYZT7s<br/>https://www.youtube.com/watch?v=7tCh1ejj8wI<br/>https://www.youtube.com/watch?v=1Mup59tbHxg<br/>https://www.youtube.com/watch?v=QuqfT6h1c4A<br/>https://www.youtube.com/watch?v=h1M3aUS5BuA<br/>https://www.youtube.com/watch?v=ButpZzn2cng<br/><br/>FOLLOW US:<br/>Website/Email List - https://www.digitaltourbus.com/#/portal/signup<br/>YouTube - https://www.youtube.com/digitaltourbus<br/>Instagram - https://www.instagram.com/digitaltourbus/<br/>TikTok - https://www.tiktok.com/@digitaltourbus<br/>Facebook - https://www.facebook.com/digitaltourbus/<br/>Twitter - https://twitter.com/digitaltourbus<br/>Pinterest - https://www.pinterest.com/digitaltourbus/<br/>LinkedIn - https://www.linkedin.com/company/digital-tour-bus-llc<br/>Spotify - https://open.spotify.com/user/digitaltourbus<br/><br/>WATCH OUR DIFFERENT VIDEO SERIES:<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_ByKsuzBlHLw8Z9vlvMHpo<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7-qmqFF3X8-CewdMmig-D2a<br/>https://youtube.com/playlist?list=PLPSOX00TLs78kkdygO4-67vxS4u5P6Qh7<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_eKAu5-RHLaIhZD07cL_iy<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7-w9-ii7pFxKrqa3Fd6zEh3<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_mIDoSuZmgzJTkhh522ZIE<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs78fQYYOLfFfCOFJOxTRfg-e<br/>https://www.youtube.com/playlist?list=PLB710EB72989541BB<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs795mjUgkfdK7YuWgwd5cluo<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7-9mycmBW-MljwWxKzQdQt2<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_w6rQHnI6TBq-tjXQsQ5lt<br/><br/>VIDEO SUMMARY:<br/>00:00 Introduction<br/>00:33 Front Lounge<br/>03:06 Bunks<br/>06:44 Back Lounge<br/><br/>ABOUT DIGITAL TOUR BUS:<br/>Digital Tour Bus is your backstage pass to your favorite touring artists! With daily video releases, we cover all genres, and have had the pleasure of featuring the likes of Matchbox Twenty, Twenty One Pilots, Megadeth, Machine Gun Kelly, Papa Roach, and thousands of others, over the past 15 years. \
⏲ 10:56 👁 45K
Pilot look from mlp pilot
⏲ 0:4 👁 10K
Subscribe to DTB at http://digtb.us/subscribe<br/>Become a member (it's FREE) at https://digtb.us/signup<br/>Buy official DTB merch at http://digtb.us/merch<br/><br/>On this episode of DTB’s “Bus Invaders”, we take you inside the touring vehicle of the pop punk band, Carly Cosgrove, while on their way to Burn Bright Fest in Milwaukee. Carly Cosgrove is currently supporting their newest single, Joan of Hill.<br/><br/>VIDEO INFO:<br/>Film Date - February 24, 2024<br/>Location - Chicago, IL<br/><br/>KEEP UP WITH CARLY COSGROVE:<br/>Facebook - https://facebook.com/CarlyCosgrovePA<br/>Instagram - https://instagram.com/carlycosgrovepa<br/>Twitter - https://twitter.com/CarlyCosgrovePA<br/><br/>WATCH MORE BUS INVADERS EPISODES:<br/>https://www.youtube.com/watch?v=NPwQrkP9P6I<br/>https://www.youtube.com/watch?v=vIo5Gl05wsM<br/>https://www.youtube.com/watch?v=i5GBEnuIReA<br/>https://www.youtube.com/watch?v=-SBs_6YHwbM<br/>https://www.youtube.com/watch?v=A7PXoVYZT7s<br/>https://www.youtube.com/watch?v=7tCh1ejj8wI<br/>https://www.youtube.com/watch?v=1Mup59tbHxg<br/>https://www.youtube.com/watch?v=QuqfT6h1c4A<br/>https://www.youtube.com/watch?v=h1M3aUS5BuA<br/>https://www.youtube.com/watch?v=ButpZzn2cng<br/><br/>FOLLOW US:<br/>Website/Email List - https://www.digitaltourbus.com/#/portal/signup<br/>YouTube - https://www.youtube.com/digitaltourbus<br/>Instagram - https://www.instagram.com/digitaltourbus/<br/>TikTok - https://www.tiktok.com/@digitaltourbus<br/>Facebook - https://www.facebook.com/digitaltourbus/<br/>Twitter - https://twitter.com/digitaltourbus<br/>Pinterest - https://www.pinterest.com/digitaltourbus/<br/>LinkedIn - https://www.linkedin.com/company/digital-tour-bus-llc<br/>Spotify - https://open.spotify.com/user/digitaltourbus<br/><br/>WATCH OUR DIFFERENT VIDEO SERIES:<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_ByKsuzBlHLw8Z9vlvMHpo<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7-qmqFF3X8-CewdMmig-D2a<br/>https://youtube.com/playlist?list=PLPSOX00TLs78kkdygO4-67vxS4u5P6Qh7<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_eKAu5-RHLaIhZD07cL_iy<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7-w9-ii7pFxKrqa3Fd6zEh3<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_mIDoSuZmgzJTkhh522ZIE<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs78fQYYOLfFfCOFJOxTRfg-e<br/>https://www.youtube.com/playlist?list=PLB710EB72989541BB<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs795mjUgkfdK7YuWgwd5cluo<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7-9mycmBW-MljwWxKzQdQt2<br/>https://www.youtube.com/playlist?list=PLPSOX00TLs7_w6rQHnI6TBq-tjXQsQ5lt<br/><br/>VIDEO SUMMARY:<br/>00:00 Introduction<br/>00:37 Driver's Area<br/>06:30 Middle of the Van<br/>12:54 Back of the Van<br/><br/>ABOUT DIGITAL TOUR BUS:<br/>Digital Tour Bus is your backstage pass to your favorite touring artists! With daily video releases, we cover all genres, and have had the pleasure of featuring the likes of Matchbox Twenty, Twenty One Pilots, Megadeth, Machine Gun Kelly, Papa Roach, and thousands of others, over the past 15 years. \
⏲ 15:1 👁 10K
Experience Virgin Galactic Unity's Galactic 02 flight with these amazing views from inside and out of suborbital space plane VSS Unity. <br/><br/>Passengers: Jon Goodwin, Keisha Schahaffand Anastatia Mayers.<br/>Crew:Commander C.J. Sturckow, pilot Kelly Latimer and Chief Astronaut Instructor Beth Moses.<br/><br/>Credit: Space.com | footage courtesy: Virgin Galactic | edited by Steve Spaleta<br/>Music: Far Far Far by Bonnie Grace / courtesy of Epidemic Sound
⏲ 4:36 👁 140K
A jawbone found in an Arizona boy's rock collection in 2002 was identified as belonging to US Marine Everett Yager. Yager died in a 1951 military plane accident over California during a training exercise. The jawbone was submitted to authorities in Arizona but initial DNA tests provided no clues. In 2023, the bone was given a genetic profile and added to genealogy databases. Ramapo College students and a high school intern worked on the cold case last summer. Ramapo College officials suggested in a news release that the jawbone from an accident over California might have been transported to Arizona by a scavenger bird.
⏲ 0:47 👁 11.6M
Pages 6 Of 7
... ...
« Previous | Next »

Related Searches

Search Videos

Recent Searches

moonlight dreams | klenie henne punktchem abc | indian aunty on | virginia dmv online account | pbs kids in julia major | অভিনেতা তবিবà§à¦² ইসলাম বাবৠ| mojflix web series | www dot bangla মাহিয়া মাহির বিডিও | dino java | bangla movie song agee2 mp3 | bangla blue com | badra bahaar queen promo | flight centre refunds latest | wwe undertaker vs lesnar vedeo movie gorom mosla song | dimmer knob switch | mypornwap co in | milon bangla mp3c 15 theme song by | maaroo aljeeziiraa | video mp4 obujh hrid | wwe marala | ok ru girls | adore adore ww বাংলা দেশি নায়িকা মাহিয়া মাহি ভিডিও রাতের নিয়ম পড়à | wale dice pinapple | ridoy banga dew movie mp3ar | لایو سکسی ساینا | চাদা চিদি বাংলা@ | yemielesho | 11 bangla six com riaz shane video | milon new lock suna song mill | mon amer kid bia nanc orin hp dhaka | sandal hatak | ইচেছ hostory tow | combat crew | la ladhashi video | kaida kan | danielle marino | e0a6aee0a787e0a6b9e0a69ce0a6bee0a6ace0a6bfe0a6a8 e0a686e0a6aae0a781e0a695e0a787 naika opu biswas mp4 and e0a6b0e0a78be0a697e0a780e0a6b0 video download | wife vlog | ggcaccatcatcaagcccaag | xcopy force file | zegy | ghost ride | ullu web series hot scene | mesozoic era timeline | bangla all dajjal | sample | bangla video sany leon inc papa angela so | tbzpg3pqsyc | e commerce | baby delivery school video | shiv song by sachit parampara | new cat ka sambalpuri বলা কথা | বেষ্ট অফ পপির গান singer james song নায়িকা পপির ছবি | wwww bangladesh | indian tv men hot underwear | dark fishing spider diet | hot pakistani grope | bd sara video | father barr picture media | fast night hot | veggietales theme song evolution | বাংলী | www com ছবি দেকতে চাই 27 ফলে মেয়েদের থেকে premi | flowers for algernon movie plot summary | rms candidate ranking | jessica flowers model | spaghetti aux palourdes | downlod 3gp com | www video অ� | salma song ami chi | prova sec video | the wee man | share price company list | ফানি ডাবিং লিখিত | oggy and roacyes | bangla pop songs 2015 | bangla hot jatra sog | bangla sonu | arfin rum audio song | আফ্রিকার মেয়েদের nenta ভিডিওময়ুর | pyhm8z x8km |